Bookmark! (press Ctrl+D)

Sars-Cov-2, the virus that causes Covid-19 is easily the most defining feature of 2020. In the last 8 months the world has changed radically and there have been plenty of fumbles as countries struggle to deal with the chaos. One of the most important issues has been testing for the virus. In this video, I aim to demystify how that testing actually works down to the chemical level and show exactly how it’s done. We’ll be covering the viruses anatomy, as well as three types of test: PCR, LAMP and Antibody.

Earlier videos:
PCR – https://youtu.be/7kJ2o7P8D00
Gel Electrophoresis – https://youtu.be/sSKls2kNC4U
___________________________________________________________________
Try tab for a cause today:
https://tab.gladly.io/thethoughtemporium/
___________________________________________________________________
00:00 – Introduction
04:00 – Virus Anatomy Overview
09:45 – PCR Overview
13:30 – Performing PCR
20:37 – Testing at Scale and Robots (Opentrons)
23:30 – LAMP overview
27:50 – Performing LAMP (Biofoundry)

30:30 – Pros/Cons of Genetic Tests

31:30 – Antibody Overview
32:50 – Performing Antibody Test

34:00 – How Antibody Tests Work
38:00 – Summary
___________________________________________________________________
Support the show and future projects:

Patreon: https://www.patreon.com/thethoughtemporium

Ko-Fi: https://ko-fi.com/thoughtemporium

Become a member: https://www.youtube.com/channel/UCV5vCi3jPJdURZwAOO_FNfQ/join
_________________________________________________________________
My Social Media Pages:

Instagram: https://www.instagram.com/thethoughtemporium/

Facebook: https://www.facebook.com/thethoughtemporium/

Twitter: https://www.twitter.com/emporiumthought

Website: http://thethoughtemporium.com/
______________________________________________________________________
More resources, and citations:

Kurzgesagt Covid Overview: https://youtu.be/BtN-goy9VOY
A great writeup about the virus’s anatomy: https://bit.ly/2FJq6G8
JOGL: https://app.jogl.io/program/opencovid19
Biofoundry: https://foundry.bio/
Student Outbreak: https://bit.ly/2Qa3vEq
Student Outbreak 2: https://bit.ly/34hQgdl
Strokes In heathy people: https://bit.ly/2QdQREK
Organ Damage: https://bit.ly/3aHONhy
Aptamer Tests: https://rsc.li/3j2Fb3I
Variations in Test Accuracy: https://bit.ly/2YlojNV
Faulty probes: https://bit.ly/3aIPlDJ
Contaminated Swabs: https://bit.ly/34fnVEt
False positives FDA: https://bit.ly/3gojBFv
E protein structure: https://bit.ly/3aN5Yyb
MERS fact sheet: https://bit.ly/2CLUaQn
Incidence of thromboembolism: https://bit.ly/2YgiBgc
Stroke study: https://bit.ly/2E59Pei
Stroke 2: https://bit.ly/2Yk8yql
Cardiac infection: https://bit.ly/3l5DaWo
Asymptomatic infection rate: https://bit.ly/2YgiOju
Asymptomatic infection study: https://go.nature.com/2CLO2rb
Organ damage in asymptomatic pateints: https://bit.ly/2YfaMHJ
Wisconsin LAMP trial: https://bit.ly/3aIQfA7
Healthy people stroke: https://bit.ly/2YmKEuB
LAMP Assay design: https://bit.ly/3aJnqUv
Mutation geneology: https://bit.ly/34hxqTs
Cardiac outcomes: https://bit.ly/3hjJBmo
False negative rate: https://bit.ly/3j47I95
ACE2 distribution: https://go.nature.com/3aJsMyR
Long Haulers article: https://bit.ly/2EgU9nP
Long haulers Video: https://youtu.be/AuKAg52mz4s
Complete protein models: https://bit.ly/32akpIS
Antibody test: https://bit.ly/2CIXT0S
_________________________________________________________________________________
Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you’d like, check out Sebastian’s work here: http://binomicalabs.org/
SpikeF – AGGAATTTTTATGAACCACAAATCA
MembraneR – CGGTGATCCAATTTATTCTGTAAAC
NucleoF – AAATGAAAGATCTCAGTCCAAGATG
NucleoR – ACAGTTTGCTGTTTCTTCTGTCTCT

Original Primers:
N1F – GACCCCAAAATCAGCGAAAT
N2F – ttacaaacattggccgcaaa
N3F – GGGAGCCTTGAATACACCAAAA
N2R – GCGCGACATTCCGAAGAA
N2-LF – gggggcaaattgtgcaatttg
N2-B3 – gacttgatctttgaaatttggatct
N2-F3 – accaggaactaatcagacaag

source

LEAVE A REPLY

Please enter your comment!
Please enter your name here